Triticum urartu (trur), Aegilops speltoides



Yüklə 94.52 Kb.
tarix22.04.2016
ölçüsü94.52 Kb.


Supplementary data

Figure S1 Multiple sequence alignment and residue conservation analysis of ALDH7 proteins in wheat (trae), Triticum urartu (trur), Aegilops speltoides (aesp), Aegilops tauschii (aeta), Brachypodium distachyon (brdi), barley (hovu), rice (orsa), sorghum (sobi), Setaria italic (seia), maize (zema), Arabidopsis (ALDH7B4), soybean (glma), Caenorhabditis elegans (cael) and human (hosa). Identical residues were displayed with black background and different ones with white. Residue positions were denoted by index numbers above the first sequence in the alignment. Stars denoted the conserved functional residues, whereas the NAD-binding domain was boxed.





Figure S2 Estimations of similarity and divergence rates of ALDH proteins in wheat (trae), Triticum urartu (trur), Aegilops speltoides (aesp), Aegilops tauschii (aeta), Brachypodium distachyon (brdi), barley (hovu), rice (orsa), sorghum (sobi), Setaria italic (seia), maize (zema), Arabidopsis (ALDH7B4), soybean (glma), Caenorhabditis elegans (cael) and human (hosa).



Figure S3 Differential expression of EST (21-1-1) encoding aldehyde dehydrogenase 7 between wheat seedlings under both normal and drought stress conditions.



Figure S4 Expression of TraeALDH7B1-5A induced by the PEG 6000 stress in 12 wheat cultivars.



Table S1 Accession numbers and species sources of ALDH7 proteins.

Gene

Accession numbers for proteins

Accession numbers

for genes



Species

traeALDH7B1-5A

ADJ67791.1

HM138347

Triticum aestivum

traeALDH7B1-5B

-

KP890930

Triticum aestivum

traeALDH7B1-5D

-

KP890931

Triticum aestivum

trurALDH7B1

EMS60592

KD107258.1

Triticum urartu

aespALDH7B1

-

KP890932

Aegilops speltoides

aetaALDH7B1

EMT27955

KD510307.1

Aegilops tauschii

hovuALDH7B1

BAJ87483

AK356265.1

Hordeum vulgare

brdiALDH7B1

XP_003578181

XM_003578133.2

Brachypodium distachyon

zemaALDH7B6

ACG34294

EU962176.1

Zea mays

orsaALDH7B6

AAG43027

AF323586.1

Oryza sativa

seitALDH7B1

XP_004956932

XM_004956875.1

Setaria italica

sobiALDH7B2

EER98972

CM000761.1

Sorghum bicolor

eugrALDH7B1

KCW71320

KK198758.1

Eucalyptus grandis

prpeALDH7B1

EMJ03142

KB639097.1

Prunus persica

potrALDH7B4

EEE84525

CM000337.2

Populus trichocarpa

euchALDH7B1

AAX09646

AY914602.1

Euphorbia characias

viviALDH7B5

CBI27794

FN595756.1

Vitis vinifera

madoALDH7B1

BAA75633

D88434.1

Malus domestica

eusaALDH7B1

ESQ30003

KI517809.1

Eutrema salsugineum

sotuALDH7B1

XP_006342925

XM_006342863.1

Solanum tuberosum

frveALDH7B1

XP_004287644

XM_004287596.2

Fragaria vesca

glmaALDH7B1

AAP02957.1

AY250704

Glycine max

caruALDH7B1

EOA40175

KB870805.1

Capsella rubella

pisiALDH7B1

ABR18443

EF678715.1

Picea sitchensis

ciarALDH7B1

XP_004488077

XM_004488020.1

Cicer arietinum

hosaALDH7B1

P49419

-

Homo sapiens

ALDH7B4

NP_175812

NM_104287.4

Arabidopsis thaliana

caelALDH7B1

P46562

-

Caenorhabditis elegans

Table S2 Primer sets used for gene expression detection in Realtime-PCR experiments.

Gene

Forward primer (5'-3')

Reverse primer (5'-3')

Reference

ABA1

GCTATGAAGGTGATCTGCTTGTGG

TTCATACCATTTGGAGCATCAGC

(Ding et al., 2009)

ABI1

AGCTGCTGATATAGTCGTCGTTGATA

GAGGATCAAACCGACCATCTAACA

(Ding et al., 2009)

ABI2

GTTCTTGTTCTGGCGACGGAGC

CCATTAGTGACTCGACCATCAAG

(Ding et al., 2009)

ABI5

AGAGGGATAGCGAACGAGTCTAGTC

GTTCGGGTTTGGATTAGGTTTAGG

(Ding et al., 2009)

CBF1

GTTTGGGATGCCGACTTTGTT

ACCATCTCCTTCGCCGTCAT

(Ding et al., 2009)

CBF2

GGGACTTTCCAAACCGCTGAG

GGATTTCCTTGGCACAGGTTGA

(Ding et al., 2009)

COR15A

GTGACGGATAAAACAAAAGAGG

GACCCTACTTTGTGGCATCCTT

(Ding et al., 2009)

COR47

ATGGCTGAGGAGTACAAGAACAACGTT

TCTTCTTCTTCTTCTCCTTCTTTTCCT

(Ding et al., 2009)

DREB1A

TGCGTTGGCGTTTCAGGATG

CAAACTCGGCATCTCAAACATCG

(Ding et al., 2009)

DREB2A

CTGGAGAATGGTGCGGAAGA

CAGATAGCGAATCCTGCTGTTGT

(Ding et al., 2009)

RAB18

GCAGTATGACGAGTACGGAAATCC

CCTTGTCCATCATCCGAGCTAGA

(Ding et al., 2009)

RD22

ACTTGGTAAATATCACGTCAGGGCT

CTGAGGTGTTCTTGTGGCATACC

(Ding et al., 2009)

RD29A

GATAACGTTGGAGGAAGAGTCGG

TCCTGATTCACCTGGAAATTTCG

(Ding et al., 2009)

RD29D

CCGACAAGAGGTGATGTGAAAGTAG

GTGTAACCTAGCTTTGAGGCAACG

(Ding et al., 2009)

ABA2

ATTGATCACTGGAGGAGCCACAG

ATTACGAATATCAGGGCACGGTG

(Ding et al., 2009)

ABI3

CACAGCCAGAGTTCCTTCCTTTACT

TAGTTGCTGAGGAACACAAACGG

(Ding et al., 2009)

ABI4

ACAAGATTTCTGACATCGAGCTCAC

ATCCATCTCCAACCATATAACCCG

(Ding et al., 2009)

CBF2

AACCAGCGGGAAGGAAGAAGT

TTTCCTTGGCACAGGTTGATT

(Ding et al., 2009)

CBF3

GATCAGCCTGTCTCAATTTC

CTTCTGCCATATTAGCCAAC

(Ding et al., 2009)

Actin 2

TATCGCTGACCGTATGAGCAAAG

TGGACCTGCCTCATCATACTCG

(Ding et al., 2009)

AREB1

AGGCGTTGGTGCTGTG

GCTTTCGTTGTAACTCGTC

(Uno et al., 2000)

AREB2

GCAACAAGAACGGATGAACCA

AAACCCTAACAACCAGAAAGCAC

This study

RD22

TTCGCGGTGTTCTACTGCC

CGGAACCGCGTAGACGG

(Wang et al., 2011)

MYC2

CGACGGCGGAGCTGGAGATTTAT

GATTCGGGTTTTCGGTTATTGTGC

(Zhai et al., 2013)

MYB2

TTTGGATGCCGAGATTAGTGG

GCTGAATTGAACGAAACCCG

(Dongwon Baek et al., 2013)

WRKY54

GCACTGCTCAGAACCATGTCAA

CAAGTCCTCACCTGTCGAAGA

(Li et al., 2013)



Table S3 Primer sets used in this research.

Name

Primer set

Primer sequence (5'-3')

Function or use in this work

TraeALDH7B1-GLA

F

CCAACCCTAGCAACAACGAG

Genome localizaion for TraeALDH7B1-5A




R

CTCAGTGCATCACCAATCTGC




TraeALDH7B1-GLB

F

TTGGAGTTGTTGGTGTCATCAC

Genome localizaion for TraeALDH7B1-5B




R

CCAAAGCAATGCAAGCATTC




TraeALDH7B1-GLD

F

GATGCACTACATGTCGTAGGCTG

Genome localizaion for TraeALDH7B1-5D




R

TGTGCAGTGGTCCCAGCAAG




TraeALDH7B1-5A- pET-30a

F

CTAGGTACCATGGCGAGCTTCGCGAG

In vitro expression, TraeALDH7B1-5A, inserted into pET-30a




R

ACCGAATTCCAGCACCAAACTAGCCGAAG




TraeALDH7B1-5A-OX

F

AGAGGATCCATGGCGAGCTTCGCGAGGCA

TraeALDH7B1-5A overexpression




R

AGAGTCGACCTAGCCGAAGTTAATTCCCTG




TraeALDH7B1-5A-GBKT

F

AGAGAATTCATGGCGAGCTTCGCGAGGCA

Y2H, TraeALDH7B1-5A, inserted into prey vector pGBKT7




R

AGAGTCGACCTAGCCGAAGTTAATTCCCTG




TraeALDH7B1-5A-AD

F

AGTCGAATTCATGGCGAGCTTCGCGAGGCA

Y2H, TraeALDH7B1-5A, inserted into AD vector




R

ATGCTCTAGATCAGCACCAAACTAGCCGAA




VDAC-AD

F

AGTCGAATTCATGGGCGGCCCAGGCCTCTA

Y2H, TaVDAC, inserted into AD vector




R

ATGCTCTAGATCAAGGCTTGAGAGCAATAG




EN1-AD

F

AGTCGAATTCATGGCGGCGACGATCCAGTC

Y2H, TaEN1, inserted into AD vector




R

ATGCTCTAGACTAGTAGGGCTCCACCGGT




CYP-AD

F

AGTCGAATTCATGGCCAACCCGAGGGTGTT

Y2H, TaCYP, inserted into AD vector




R

ATGCTCTAGACTAGAGCTGGCCGCAGTCG




GST-AD

F

AGTCGAATTCATGGCGGCGCGCGTGACGGT

Y2H, TaGST, inserted into AD vector




R

ATGCTCTAGATCAAGCTTTAGAGGGTCGTG




ATPSS-AD

F

AGTCGAATTCATGTCGTACTCCCACCTCTC

Y2H, TaAPSS, inserted into AD vector




R

ATGCTCTAGATCAGCCGGACAGGGCGTCGG




TraeALDH7B1-5A-BD

F

AGTCGAATTCATGGCGAGCTTCGCGAGGCA

Y2H, TraeALDH7B1-5A inserted into BD vector

 

R

ATGCGTCGACTCAGCACCAAACTAGCCGAA

 

Table S4 Putative interaction proteins of TraeALDH7B1-5A.

Gene annotation

Detect Frequency

ALDH7B

18

Voltage-dependent anion-selective channel protein, VDAC

3

Enolase

3

TaCyP1 (cyclophilin A-1)

1

Glutathione S-transferase F11-like

1

ATP synthase subunit

1




Yüklə 94.52 Kb.

Dostları ilə paylaş:




Verilənlər bazası müəlliflik hüququ ilə müdafiə olunur ©azrefs.org 2020
rəhbərliyinə müraciət

gir | qeydiyyatdan keç
    Ana səhifə


yükləyin