Supplementary material Supplementary methods Vector construction




Yüklə 29.61 Kb.
tarix11.03.2016
ölçüsü29.61 Kb.
Supplementary material
Supplementary methods

Vector construction

To construct the miR-1228 expression vector (pcDNA3/pri-miR-1228), we first amplified a DNA fragment carrying pri-miR-1228 from genomic DNA using the pri-miR-1228-sense (S) and -antisense (AS) primers shown in Supplementary Table 1. The amplified fragment was then cloned into the pcDNA3 vector using the EcoRI and BamHI sites.

To construct the enhanced green fluorescent protein (EGFP) reporter plasmid, the wild-type p53 mRNA 3’UTR was amplified by PCR using the TP53-1228-3’UTR-S and -AS primers and was inserted into downstream of the EGFP gene between the EcoRI and BamHI (TaKaRa, Madison, WI) sites in the pcDNA3/EGFP plasmid. Additionally, a 3’UTR fragment containing the mutated miR-1228 binding site was amplified using PCR site-directed mutagenesis. The two additional primers were TP53-1228-3’UTR-MS and -MA. The PCR product was inserted into the pcDNA3/EGFP plasmid using the same sites to form the reporter vector pcDNA3/EGFP-p53-3’UTR mut. The 2-O’-methyl- and 3’-amino-C6-modified anti-miRNA oligomers (ASO-miR-1228 and ASO-NC) were obtained from Shanghai GIMA Company.

The 866 bp and 1546 bp miR-1228 promoter regions spanning from -1328 bp upstream to -462 or 218 of the LRP1 5’UTR were amplified from the genomic DNA of QGY-7703 cells using the primers LRP1/miR-1228p-S, LRP1/miR-1228-p1546-AS, and LRP1/miR-1228-p866-AS, as shown in Supplementary Table 1. The fragments were then inserted into the KpnI and EcoRI restriction sites of the pGL3 basic luciferase reporter vector (Promega, Madison, WI). The constructs were designated as pGL3-Basic-luc+ LRP1/miR-1228-p866 or LRP1/miR-1228-p1546. The primers used to construct the mutant promoters (LRP1/miR-1228-mut-S and LRP1/miR-1228-mut-AS) are also shown in Supplementary Table 1. The mutated fragment was amplified using a PCR site-directed mutagenesis assay, and the fragment was then inserted into the pGL3 basic luciferase reporter vector using the same sites to form the LRP1/miR-1228-mut. reporter vector (Figutr 5D, where the red letters indicate the sites of mutation). The details of the primer sequences can be found in Supplementary Table 1.



RNA extraction and quantitative reverse-transcription PCR (qRT-PCR)

Total RNA was extracted using the Trizol reagent (Invitrogen) and was reverse transcribed to generate cDNA using oligo-dT primers (for mRNA) or stem-loop reverse transcriptase (RT) primers (for miRNA). Quantitative RT-PCR was performed in a LightCycler (Bio-Rad, Hercules, CA) using the SYBR Premix Ex Taq. U6 snRNA and the β-actin housekeeping gene were used as endogenous controls for miRNA and mRNA, respectively. For mature miRNAs, the reactions were incubated at 94°C for 10 min, followed by 40 cycles of 94°C for 30 s, 60°C for 30 s, and 72°C for 30 s. For mRNA, the following conditions were used: 94°C for 10 min, followed by 40 cycles of 94°C for 30 s, 56°C for 30 s, and 72°C for 30 s. The details of the primer sequences can be found in Supplementary Table 1.



Western blot

To harvest the total protein, the cells were lysed with RIPA lysis buffer. Cell lysates was separated on 10% SDS denaturing PAGE gels and were transferred to the nitrocellulose membranes (HybondECL). The membranes were then blocked in PBS/Tween-20 containing 5% nonfat milk. The membranes were incubated overnight at 4°C with polyclonal rabbit anti-p53 and rabbit anti-GAPDH antibodies (Saierbio, Tianjin, China). The membranes were then washed and incubated with anti-rabbit IgG-HRP for 2 hrs. The protein expression level was assessed by enhanced chemiluminescence and exposure to chemiluminescent film (Fujifilm, Tokyo, Japan). Lab Works image acquisition and analysis software (UVP) was used to quantify the band intensities.



Detection of cell viability

The 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyl-tetrazolium bromide (MTT) assay and cell proliferation assay was performed to evaluate the cell viability and proliferative capacity of HCC cell lines under various conditions. For the MTT assay, 10 000 HepG2 cells or 5 000 QGY-7703 cells were seeded into 96-well plates twenty to twenty-four hours after transfection with pri-miR-371 or ASO-miR-371-5p. At 72 hours after transfection, 10 µL of MTT (0.5%) was added to the culture solution. The cells were incubated at 37 °C for 4 hours, the medium was removed. To dissolve the formazan, 100 µL of DMSO was added, and a µQuant universal microplate spectrophotometer (Bio-Tek Instruments, Winooski, VT) was used to observe the absorbance at 570 nm (A570).



Terminal deoxyribonucleotide transferase-mediated dUTP nick end labeling (TUNEL)

DNA fragmentation of individual cells was detected with the In Situ Cell Death Detection kit, Fluorescein (Roche Molecular Biochemicals), as detailed previously. TUNEL staining was analysed with a confocal microscope .



Cell colony formation

Hepatocellular carcinoma cells were seeded in 96-well plates. Twenty-four hours later, the cells were transfected with pcDNA3-p53 and shR-p53 or the corresponding controls. For colony formation, the cells were counted and seeded in 12-well plates at a density of 300 (QGY-7703) or 800 (HepG2) cells per well after transfection. Culture medium was replaced every 3 days. On the 10th-14th day after seeding, the cells were stained using crystal violet, and each colony with a minimum of 50 cells was counted.



Migration and invasion assays

For the transwell migration assay, QGY-7703 or HepG2 cells were trypsinized 24 hours after transfection. Then, 5×104 QGY-7703 cells or 12×104 HepG2 cells in 0.2 ml RPMI-1640 or MEM- without fetal bovine serum (FBS) were placed in the top chamber of each insert (Millicell, Millipore) without Matrigel. For the invasion assay, before placing the cells, each insert was coated with 40 l of Matrigel (Clontech, Mountain View, CA), which was diluted to 4 g/l with RPMI-1640 medium for the QGY-7703 cells or 1 g/l with MEM-α medium for the HepG2 cells. The lower chamber was filled with 700 l of RPMI-1640 medium for the QGY-7703 cells or MEM- medium for the HepG2 cells; both media were supplemented with 20% FBS to act as a nutritional attractant. After several hours of incubation (10 hrs for QGY-7703 and 22 hrs for HepG2 in the migration assays; 24 hrs for QGY-7703 and 48 hrs for HepG2 in the invasion assays), the migrated cells that were attached to the lower surface were fixed with 20% methanol, followed by staining with crystal violet for 30 min. Once dry, the membranes were excised from the insert and embedded under cover slips to quantify the migrated cells; five random fields of view were counted for each membrane. All assays were repeated at least in triplicate, and the results are expressed as the mean ± SD.



Cell cycle analysis by flow cytometry

Transfected QGY-7703 cells were plated in duplicate in 6-well plates and incubated for 24 h in complete culture medium. One group of cells was deprived of serum for 24 h prior to harvest, whereas another group of cells was returned to complete medium for another 24 h before harvest. The cells were collected by centrifugation, fixed in 95% (v/v) ethanol, and stored at -20°C overnight. After washing with phosphate-buffered saline (PBS), the cells were resuspended in propidium iodide (PI) staining buffer (PBS, 0.1% Triton X-100, 60 g/ml PI, 0.1 mg/ml DNase-free RNase, and 0.1% trisodium citrate) for 30 min on ice. The DNA content was analyzed using a FACSCalibur flow cytometer (BD Biosciences) and Cell Quest software (BD Biosciences).


Supplementary figures and figure legends


Supplementary Figure 1. Ectopic expression of miR-1228 shows no obvious effect on cell viability. MTT assays of QGY-7703 (A) and HepG2 (B) cells that were transiently transfected with pcDNA3/pri-miR-1228, ASO-miR-1228, or a control vector. (C) Apoptosis of QGY-7703 cells transfected with pri-miR-1228 or pcDNA3 as controls.



Supplementary Figure 21. miR-1228 promotes the growth and migration/invasion of HepG2 cells. (A) Colony formation assays of HepG2 cells that were transiently transfected with pcDNA3/pri-miR-1228, ASO-miR-1228, or a control vector. (B) Transwell migration assay of HepG2 cells. (C) Transwell invasion assay of HepG2 cells. Representative images are shown. Cells in five random fields of view were counted at 100× magnification.

Supplementary Figure 32. p53 inhibits the proliferation of QGY-7703 and HepG2 cells. (A and B) p53 mRNA and protein levels were examined by qRT-PCR and western blot analysis, respectively; 48 hours later, the cells were transfected with the shR-p53, pcDNA3-p53, or a control vector. β-actin and GAPDH were used as the internal controls for quantitative normalization, and the control groups transfected with the pcDNA3 empty vector or shR-NC were set to 1. (C and D) QGY-7703 cells were transfected with either pcDNA3-p53 or shR-p53 and were seeded to reveal the cell growth ability. The results for the HepG2 cells were similar to the colony formation results in the QGY-7703 cells.



Supplementary Figure 43. p53 inhibits the metastasis of QGY-7703 and HepG2 cells. (A and B) The transwell migration and (C and D) invasion assays were performed to evaluate the metastatic capacity of the QGY-7703 and HepG2 cells after transfection with pcDNA3-p53, shR-p53, or their control plasmids.



Supplementary Figure 54. Restoration of p53 abrogates the effects induced by miR-1228 in HepG2 cells. (A) The colony formation assay revealed that with miR-1228 present, the average colony formation rate in the HepG2 cells was decreased following expression of p53 without a 3’UTR. (B) Ectopic expression of p53 without a 3’UTR decreased the migration of the HepG2 cells when miR-1228 was present. The average number of migrated cells was determined from three independent experiments. (C) Similar results for the cell invasion assay were obtained in the HepG2 cells.

Supplementary Table 1.

Sequence of the primers used in this study.

Primer

Sequence(5'-3')

pri-miR-1228-S

CATTCGGATCCCAAGAACAGACTCGCAC

pri-miR-1228-AS

GGGAGAATTCGGGGAGAGTTCAGGTAGATG

ASO-miR-1228

GGGGGGCGAGGCAGGTGTGA

ASO- NC

GTGGATATTGTTGCCATCA

TP53-1228-3'UTR-S

CATGGATCCCTTGTTCCCCACTGACAGCC

TP53-1228-3'UTR-AS

CTTGAATTCTCCCCATCCTCCTCCCCACAAC

TP53-1228-3'UTR-MS

CCTTGCTTGCAATACCTCTCCGTCAGAAGCACC

TP53-1228-3'UTR-MA

GGTGCTTCTGACGGAGAGGTATTGCAAGCAAGG

TP53-qPCR-S

TTGAGGTGCGTGTTTGTG

TP53-qPCR-A

AGTTTTTTATGGCGGGAG

β-actin-S

CGTGACATTAAGGAGAAGCTG

β-actin-AS

CTAGAAGCATTTGCGGTGGAC

miR-1228 RT

GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGGGGG

miR-1228 Forward

TCACACCTGCCTCG

U6 RT primer

GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAATATGGAAC

U6 Forward primer

TGCGGGTGCTCGCTTCGGCAGC

Reverse primer

CCAGTGCAGGGTCCGAGGT

LRP1/miR-1228p-S

GGGGTACCGGAGGCAAGTCCTTCGTG

LRP1/miR-1228-p1546-AS

CGGAATTCTTCACTCCTCGCTGCTCT

LRP1/miR-1228-p866-AS

CGGAATTCTGAAGGTGCCTCCTCTGC

LRP1/miR-1228-mut-S

GCGGGCGTCGACAGACTCAGGTGTCCCCTCGGGACACTGTGTTTAC

LRP1/miR-1228-mut-AS

GTAAACACAGTGTCCCGAGGGGACACCTGAGTCTGTCGACGCCCGC


Reference

Xiao J, Lin H, Luo X, Luo X, Wang Z (2011). miR-605 joins p53 network to form a p53:miR-605:Mdm2 positive feedback loop in response to stress. The EMBO journal 30(24): 5021.






Verilənlər bazası müəlliflik hüququ ilə müdafiə olunur ©azrefs.org 2016
rəhbərliyinə müraciət

    Ana səhifə