Supplementary Information Molecular detection of anammox bacteria in terrestrial ecosystems: distribution and diversity




Yüklə 58.01 Kb.
tarix26.04.2016
ölçüsü58.01 Kb.
Supplementary Information
Molecular detection of anammox bacteria in terrestrial ecosystems: distribution and diversity
Sylvia Humbert1, Sonia Tarnawski1, Nathalie Fromin2, Marc-Philippe Mallet1, Michel Aragno1 and Jakob Zopfi1, 3 *

1 Laboratory of Microbiology, Institute of Biology, University of Neuchâtel,

Emile-Argand 11, PO Box 158, CH-2009 Neuchâtel, Switzerland



2 Centre d’Ecologie Fonctionnelle et Evolutive, UMR 5175,

1919 Route de Mende, 34293 Montpellier cedex 5, France



3 Laboratory of Biogeosciences, Institute of Geology and Palaeontology,

University of Lausanne, 1015 Lausanne, Switzerland




*) For correspondence: jakob.zopfi@unil.ch
Material and Methods
Choice of sites and samples

According to the hypothesis that anammox bacteria may thrive at oxic/anoxic interfaces in soils, different locations encompassing a wide variety of suitable ecosystems were selected for sampling:



  1. Wetlands in the Camargue (southern France), in the « Grande Cariçaie » (Swiss plateau), and in the « Alpe di Cadagno » (Swiss Alps, Canton of Ticino, CH).

  2. Lake shores where water table fluctuations create temporally and spatially dynamic oxic/anoxic interfaces (Lake Neuchâtel and Lake Loclat, Swiss plateau).

  3. Anthropogenic N-enriched sites, such as an ammonium-contaminated porous aquifer in the Rhone valley (Canton of Valais, CH) as well as an intensively N-fertilized agricultural field in Boudry (Canton of Neuchâtel, CH).

  4. Soils subjected to freeze/thawing cycles resulting in oxic/anoxic transients: including a permafrost soil (Creux-du-Van, Jura Mountains, Canton of Neuchâtel, CH) and a glacier forefield (Morteratsch glacier, Engadin, Canton of Graubünden, CH).

These sites allowed sampling of different types of microenvironments, plant-related or not, providing conditions a priori favourable to anammox bacteria at oxic/anoxic interfaces. In oxic soils: rhizosphere fraction (ORS) of Urtica dioica, Alnus viridis, Rumex alpinus, Filipendula ulmaria and Carex davalliana; bulk soils (OBS) in the neighbourhood of Alnus incana, Fraxinus excelsior and Zea mays, as well as in the groundwater table-soil interface (OGSI). In water saturated soils: rhizosphere fraction (SRS) of Phragmites australis and Cladium mariscus, as well as anoxic bulk soils (SBS) and water-soil interfaces (SWSI) in marsh sediment or salisodisol.



Sampling

The geographical coordinates of the sampling sites including information about vegetation and, sampled soil fractions are presented in Table 1 together with the anammox screening results. Some additional data on the general soil characteristics can be found in Table S1. Two soil fractions were sampled whenever possible: rhizosphere soil (RS) was the fraction of soil remaining attached to the roots after gentle shaking, whereas bulk soil (BS) was sampled at distance from the roots. Soil and sediment samples were frozen on-site in liquid nitrogen, transported to the laboratory and stored at -80°C until DNA was extracted.



Table S1: Soil sample characteristics




Location

Sampled environment a

Porosity (%)

pHH2O

Ctot [%]

Ntot [%]

Grande Cariçaie (CH)

Cladietum (Cladium mariscus)

83

7.1

34

1.3

Wallis (CH)

Porous aquifer (3.70 m)

17

7.7

1.5

1.7

Shore Lake Neuchâtel (CH)

Fraxinion (Alnus incana)

31

7.4

6.8

0.2

Creux-du-Van (CH)

Permafrost

10

5.4

44.6

1.3

Shore Lake Loclat (CH)

Fraxinion (Fraxinus excelsior)

59

7.3

26.3

1.7




Reductisol (0-35cm)

49

7.5

12.7

0.2


a The sampled plant species in the respective plant association is given in parenthesis






DNA extraction and PCR amplification

Total genomic DNA was extracted from about 0.5 g (ww) of soil with the FastDNA SPIN kit for soil (BIO 101, Qbiogene Inc., Carlsbad, CA, USA) according to the protocol of the manufacturer. Concentration and quality of DNA extracts were determined by using NanoDrop ND-1000. The amplifiability of the extracted DNA was subsequently tested by PCR with universal primers targeting the 16S rDNA of Eubacteria (Muyzer et al., 1993). Different combinations of the primers (Supplementary Table S1) were tested for the amplification of Planctomycetales and anammox bacterial 16S rDNA, whereby a sequential PCR approach was finally chosen based on the amplification yield and the absence of unspecific PCR products with positive controls. In the first PCR round Planctomycetales 16S rDNA was amplified with Pla46f as forward and Univ1390r as reverse primer. The second, anammox bacteria specific PCR was performed by using Amx368f and either Amx820r or BS820r (Schmid et al., 2005). The first PCR reaction mixture was prepared in a final volume of 20 µl, containing 2mM MgCl2, 1X PCR buffer, 0.2mM of each dNTP, 0.3 µM of each primer, 0.025 U GoTaq polymerase (Promega AG, Dübendorf, Switzerland) and 2 µl of 1-5ng/µl DNA extract. The nested PCR mixture was similar to the first one except that 0.25 mM of each dNTP, 0.25 µM of each primer and 2 µl of tenfold diluted PCR product were used. PCR was done on a PTC-200 Bioconcept (MJ Research Inc., Watertown, MA, USA) thermocycler using the following parameters for both PCR amplifications: initial denaturation step of 2 min at 95°C, followed by 30 cycles of denaturation at 95°C for 45 s, annealing at 62°C for 50 s and elongation at 72°C for 1 min 22 s. The final elongation step was set at 72°C for 5 min. Negative controls (Escherichia coli and Pseudomonas fluorescens DNA) and positive controls (DNA of anammox enrichment cultures from M. Schmid (Nijmegen, NL) and from waste water treatment plants of Neuchâtel and Visp (CH)) were included routinely. The expected amplicon length was 1350 bp for the Planctomycetales PCR and 480 bp for the anammox PCR.



Table S2: PCR primers combinations used for 16S rRNA gene sequence amplification of Planctomycetales and anammox bacteria.



Primer combination

Target group

Primer sequence (5’-3’)

Annealing

temperature



Reference

Pla46f

Univ1390r



Planctomycetales

Bacteria

GGATTAGGCATGCAAGTC

GACGGGCGGTGTGTACAA



62 C°

Neef et al., 1998

Zheng et al., 1996



Amx368f

Amx820r


Anammox organisms

Ca. Brocadia’ and ‘Ca. Kuenenia’



TTCGCAATGCCCGAAAGGAAAA

CCCCTCTACTTAGTGCCC



62 C°

Schmid et al., 2003

Schmid et al., 2000



Amx368f

BS820r


Anammox organisms

Ca. Scalindua wagneri’’ and ‘Ca.Scalindua sorokinii



TTCGCAATGCCCGAAAGG

TAATTCCCTCTACTTAGTGCCC



62 C°

Schmid et al., 2003

Kuypers et al., 2003





Evaluation of PCR protocol

A PCR approach has been established to provide a method of screening environmental samples for the presence of anammox bacteria. Based on published PCR primers for anammox or Planctomycetales bacteria, different combinations of primer sets (Supplementary Table S1) have been tested. Since direct amplification of anammox 16S rRNA genes with Amx368f/Amx820r was not successful with most soil samples (data not shown), an additional PCR step was usually required to increase the template number of planctomycetes (Schmid et al., 2005). The suitability of two reverse primers (Amx820r and BS820r, Table S2) was further tested using DNA extracts from an ammonium-contaminated porous aquifer. Two clone libraries were constructed and the clone sequences retrieved using both primer sets were affiliated to anammox bacteria candidate genera and were highly similar (99% sequence similarity). Similar results were reported by Amano et al. (2007) who observed no significant differences between clone libraries constructed with either of these two reverse primers.

Finally, a sequential PCR approach was selected for the amplification of 16S rRNA genes of anammox organisms using primers sets Pla46f/Univ1390r and Amx368f/Amx820r at an annealing temperature of 62°C. PCR products of expected size were obtained following this protocol with DNA from enrichment cultures as well as from soil and sediment samples (Table 1). In samples where anammox 16S rDNA sequences were low abundant or absent, unspecific amplifications were sometimes observed (Supplementary Figures S1 and S2). Since the amplifiability of the extracted DNA had been verified beforehand, failure to produce any PCR product of the correct size was taken as absence anammox bacteria.
Clone library production, analysis and sequencing

PCR products were purified with the Wizard SV Gel and PCR Clean-up System (Promega), ligated into pGEM-T vector (Promega) and used for transformation of electrocompetent E. coli XL1 cells. After blue/white screening 6 to 50 transformants per sample were randomly selected to constitute the clone library. The inserted DNA was amplified using primers T7 / SP6, and submitted to RFLP analysis using MspI (Promega). Clone inserts displaying identical restriction patterns were grouped into Operational Taxonomic Units (OTUs). Plasmids were extracted and purified using the Wizard®Plus SV Miniprep System (Promega). Two clones per OTU and environment were sent for sequencing at MWG-Biotech (Ebersberg, Germany), whereby only OTUs consisting of more than two clones were considered. The phylogenetic affiliation of corresponding organisms was determined using BLAST (Altschul et al., 1997) and Ribosomal Database Project-II (Cole et al., 2005). A total of 440 nucleotide positions per sequence were aligned using the ClustalW implementation of MEGA4 (Tamura et al., 2007), which was also used to calculate NJ and ML trees. Nucleotide sequences have been deposited in the EMBL sequence database under accession numbers FM174251 to FM174320.


Supporting Data



Figure S1: Anammox nested PCR results of Lake Loclat shore samples.
L : Ladder 100 bp

  1. Phragmites australis, roots

  2. Phragmites australis, rhizosphere

  3. Fraxinus excelsior, rhizosphere 0-20cm

  4. Fraxinus excelsior, rhizosphere 20-40cm

  5. Fraxinus excelsior, rhizosphere 40-60cm

  6. Fraxinus excelsior, rhizosphere 60-80cm

  7. Fraxinus excelsior, rhizosphere 80-100cm

  8. Reductisol, 0-5cm

  9. Reductisol, 5-10cm

  10. Reductisol, 10-20cm

  11. Reductisol, 20-35cm

  12. Urtica dioica, rhizosphere

  13. Filipendula ulmaria, rhizosphere

+ Positive control, enrichment culture

- Negative control, E.coli

- Negative control, water






Figure S2: Anammox nested PCR results: Camargue samples.

L : Ladder 100 bp



  1. Phragmites australis, bulk soil

  2. Phragmites australis, roots

  3. Phragmites australis, rhizosphere

  4. Marsh sediment, water-soil interface

  5. Marsh sediment, bulk soil

  6. Marsh sediment, bulk soil

  7. Phragmites australis, bulk soil

  8. Phragmites australis, roots

  9. Phragmites australis, rhizosphere

  10. Fallow field, water saturated

  11. Fallow field, water saturated

  12. Grassland, water saturated

  13. Grassland, water saturated

  14. Phragmites australis roots

  15. Phragmites australis rhizosphere

  16. Salisodisol

+ Positive control, enrichment culture

- Negative control, E.coli

- Negative control, water




Figure S3: Neighbour-joining tree showing the phylogenetic relationship between the 16S rDNA sequences retrieved from different terrestrial environments, known anammox bacteria, and representatives of cultivated Planctomycetes. Clones are labeled as follows: sample name (as in Table 1) - clone number - soil fraction. The scale bar represents 5% sequence divergence and filled diamonds at nodes indicate bootstrap values above 50% (1000 replicates).

References
Altschul SF, Madden TL, Schaffer AA, Zhang JH, Zhang Z, Miller W, and Lipman DJ. (1997). Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic. Acids. Res. 25: 3389-3402

Amano T, Yoshinaga I, Okada K, Yamagishi T, Ueda S, Obuchi A et al. (2007). Detection of anammox activity and diversity of anammox bacteria-related 16S rRNA genes in coastal marine sediment in Japan. Microbes Environ. 22: 232-242

Cole JR, Chai B, Farris RJ, Wang Q, Kulam SA, McGarrell DM et al. (2005). The Ribosomal Database Project (RDP-II): sequences and tools for high-throughput rRNA analysis. Nucleic Acids Res. 33: D294-D296

Kuypers MMM, Sliekers AO, Lavik G, Schmid MC, Jørgensen BB, Kuenen JG et al. (2003). Anaerobic ammonium oxidation by anammox bacteria in the Black Sea. Nature 422: 608-611

Muyzer G, Dewaal EC, and Uitterlinden AG. (1993). Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl. Environ. Microbiol. 59: 695–700

Neef A, Amann R, Schlesner H, and Schleifer KH. (1998). Monitoring a widespread bacterial group: in situ detection of planctomycetes with 16S rRNA-targeted probes. Microbiology-Uk 144: 3257-3266

Schmid MC, Maas B, Dapena A, van de Pas-Schoonen K, van de Vossenberg J, Kartal B et al. (2005). Biomarkers for in situ detection of anaerobic ammonium-oxidizing (anammox) bacteria. Appl. Environ. Microbiol. 71: 1677-1684

Schmid MC, Twachtmann U, Klein M, Strous M, Juretschko S, Jetten MSM, Metzger J, Schleifer KH, and Wagner M. (2000). Molecular evidence for genus level diversity of bacteria capable of catalyzing anaerobic ammonium oxidation. Syst. Appl. Microbiol. 23:93–106

Schmid MC, Walsh K, Webb R, Rijpstra WIC, van de Pas-Schoonen K, Verbruggen MJ et al. (2003). Candidatus "Scalindua brodae", sp. nov., Candidatus "Scalindua wagneri", sp. nov., two new species of anaerobic ammonium oxidizing bacteria. Syst. Appl. Microbiol. 26: 529-538

Tamura K, Dudley J, Nei M, and Kumar S. (2007). MEGA4: Molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24: 1596-1599



Zheng D, Alm EW, Stahl DA, and Raskin L. (1996). Characterization of universal small-subunit rRNA hybridization probes for quantitative molecular microbial ecology studies. Appl. Environ. Microbiol. 62: 4504-4513






Verilənlər bazası müəlliflik hüququ ilə müdafiə olunur ©azrefs.org 2016
rəhbərliyinə müraciət

    Ana səhifə