Supplemental Data. Schilmiller et al. (2015). Plant Cell 10. 1105/tpc. 15. 00087 Supplemental Dataset 4




Yüklə 65.19 Kb.
tarix11.03.2016
ölçüsü65.19 Kb.
Supplemental Data. Schilmiller et al. (2015). Plant Cell 10.1105/tpc.15.00087
Supplemental Dataset 4. CLUSTAL W(1.81) multiple sequence alignment used for the phylogenetic tree in Supplemental Figure S8G.

LA2861-F/1-1290 ATGGCATCATCAAAAATGATATCTAGAAAAATGAtTAAaCTTTtATCCCCAaCTCCTCCT

LA1777-F/1-1290 ATGGCATCATCAAAAATGATATCTAGAAAAATGATTAAACTTTTATCCCCAACTCCTCCT

LA1978-F/1-1290 ATGGCATCATCAAAAATGATATCTAGAAAAATGATTAAACTTTTATCCCCAACTCCTCCT

LA2098-P/1-1287 ATGGCATCATCAACAATTATATCTAGAAAAATGATTAAACTTTTATCCCCaACTCCTCCT

LA2861-P/1-1287 ATGGCATCATCAAAAATGATATCTAGAAAAATGATTAAACTTTTaTCCCCaACTCCTCCT

LA1978-P/1-1287 atggcatcatcaacaattatatctagaaaaatgattaaacttttatCCCCAaCTCCTCCT

LA0716/1-1287 atggcaTCATCAACAATTATATCTAGAAAAATGATTAAACTTTTATCCCCaACTCCTCCT

Solyc11g067290/1-1284 ATGGCATCATCAACCATTCTTTCTAGGAAAATGATTAAACTTTTATCCCCAACTCCATCT

Solyc11g067330/1-1302 ATGGCCTCATCAACAATTCTTTCAAGAAAATTCATTAAGCCTTCTCCCCCCACCCCTTCT

Solyc11g067340/1-1302 ATGGCCTCATCAACAATTCTTTCAAGAAAAATCATTACACCTTCTCCCCCCACCCCTTCT

SlASAT3/1-1293 ATGGCATCATCAACAATTATATCTAGAAAAATGATTAAACTTTTATCCCCAACTCCATCT

LA2204-ASAT3-like2/1-1290 ATGGCATCATCAACAATTATATCTAGAAAAATGATTAAACTTTTATCCCCAACTCCCCCT

LA2204-ASAT3-like1/1-1290 ATGGCATCATCAAAAATGATATCTAGAAAAATGATTAAACTTTTaTCCCCAaCTCCCCCT

LA2156-ASAT3-like/1-1290 ATGGCATCATCAAAAATGATATCTAGAAAAATGATTAAACTTTTATCCCCaACTCCCCCT

***** ******* ** * ** ** *** * **** * ** **** ** ** **

LA2861-F/1-1290 TCACTTAGATGTCaCAAACTCTCTTTTATGGATCACATAAATCTTCCTCTACATTCTCCA

LA1777-F/1-1290 TCACTTAGATGTCACAAACTCTCTTTTATGGATCACATAAATCTTCCTCTACATTCTCCA

LA1978-F/1-1290 TCACTTAGATGTCACAAACTCTCtTTTATGGATCACATAAATCTTCCTCTACATTCTCCA

LA2098-P/1-1287 TCaCTTAGATGTCACAAACTCTCTTTTATGGATCACATAAATTTTCATCTGCATTCTCCA

LA2861-P/1-1287 TCACTTAGATGTCACAAACTCTCTTTTATGGATCACATAAATTTTCATCTGCATTCTCCA

LA1978-P/1-1287 TCaCTTAGATGTCACAAACTCTCTTTTATGGATCACATAAATTTTCATCTGCATTCTCCA

LA0716/1-1287 TCACTTAGATGTCACAAACTCTCTTTTATGGATCACATAAATTTTCATCTGCATTCTCCA

Solyc11g067290/1-1284 TCACTTAGACATCACAAATTATCTTTCATGGATTGCATAAACCTTCCTCAATATTCCCCA

Solyc11g067330/1-1302 TCACATAGACATTACAATCTCTCATTTAGAGATCAAACAGCTAATAATCTATATTTACCA

Solyc11g067340/1-1302 TCACATAGACATTGCAATCTCTCATTTAGAGATCAAACAGCTAATACTCTATATTTACCA

SlASAT3/1-1293 TCACTTAGATGTCACAAACTCTCTTTCATGGATCACATAAATTTCCCTCTACATTCTCCA

LA2204-ASAT3-like2/1-1290 TCACTTAGATGTCACAAACTCTCTTTTATGGATCACATAAATTTTCATCTGCATTCTCCA

LA2204-ASAT3-like1/1-1290 TCaCTTAGATGTCACAAACTCTCTTTTATGGATCACATAAATCTTCCTCTACATTCTCCA

LA2156-ASAT3-like/1-1290 TCACTTAGATGTCACAAACTCTCTTTTATGGATCACATAAATCTTCCTCTACATTCTCCA

**** **** * *** * ** ** * *** * * ** *** ***

LA2861-F/1-1290 TGTGCCTTCTTCTACCCTAAAATACCTCAAAATTATAGTAACAAAATATCACAAATACTT

LA1777-F/1-1290 TGTGCCTTCTTCTACCCTAAAATACCTCAAAATTATAGTAACAAAATATCACAAATACTT

LA1978-F/1-1290 TGTGCCTTCTTCTACCCTAAAATACCTCAAAATTATAGTAACAAAATATCACAAATACTT

LA2098-P/1-1287 TATGCCTTCTTCTACCCTAAAATACCTCAAAATTATAGTAGCAAAATATCACAAATACTT

LA2861-P/1-1287 TATGCCTTCTTCTACCCTAAAATACCTCAAAATTATAGTGGCAAAATATCACAAATACTT

LA1978-P/1-1287 TATGCCTTCTTCTACCCTAAAATACCTCAAAATTATAGTAGCAAAATATCACAAATACTT

LA0716/1-1287 TATGCCTTCTTCTACCCTAAAATACCTCAAAATTATAGTAGCAAAATATCACAAATACTT

Solyc11g067290/1-1284 TTTGCCTTCTTATACCCTAAACCTAAAAATCATACCAAAACACAAATATCACAAATTCTT

Solyc11g067330/1-1302 ATTGCTGCCTTGTACTCTAAACCTGAAAATCACACCATAACTCAAATATCCAATATTCTT

Solyc11g067340/1-1302 ATTGCTGCCTTGTACTCTAAACCTGAAAATCATACCATAACTCAAATATCCAATATTCTT

SlASAT3/1-1293 TATGCCTTCTTCTACCCTAAAATACCTCAAAATTATAGTAACAAAATATCACAAGTACTT

LA2204-ASAT3-like2/1-1290 TATGCCTTCTTCTACCCTAAAATACCTCAAAATTATAGTAGCAAAATATCACAAATACTT

LA2204-ASAT3-like1/1-1290 TATGCCTTCTTCTACCCTAAAATACCTCAAAATTATAGTAACAAAATATCACAAATACTT

LA2156-ASAT3-like/1-1290 TATGCCTTCTTCTACCCTAAAATACCTCAAAATTATAGTAACAAAATATCACAAATACTT

*** *** *** ***** * * * ******* * * ***

LA2861-F/1-1290 GAAAATTCCCTTTCAAAAATATTATCCTTTTATTATCCCTTAGCGGGAAAAATCAATAAT

LA1777-F/1-1290 GAAAATTCCCTTTCAAAAATATTATCCTTTTATTATCCCTTAGCGGGAAAAATCAATAAT

LA1978-F/1-1290 GAAAATTCCCTTTCAAAAATATTATCCTTTTATTATCCCTTAGCGGGAAAAATCAATAAT

LA2098-P/1-1287 GAAAATTCCCTTTCAAAAGTATTATCCTTTTATTATCCCTTAGCGGGAAAAATCAATAAT

LA2861-P/1-1287 GAAAATTCCCTTTCAAAAGTATTATCCTTTTATTATCCCTTAGCGGGAAAAATCAATAAT

LA1978-P/1-1287 GAAAATTCCCTTTCAAAAGTATTATCCTTTTATTATCCCTTAGCGGGAAAAATCAATAAT

LA0716/1-1287 GAAAATTCCCTTTCAAAAGTATTATCCTTTTATTATCCCTTAGCGGGAAAAATCAATAAT

Solyc11g067290/1-1284 GAAAACTCCCTTTCAAAAGTACTATCCTCTTATTATCCCTTCGCGGGACGAATCAAGGAT

Solyc11g067330/1-1302 GAAAATTCCCTTTCAAAAATATTATTCTTTTATTATCCCTTCGGGGGACGTATCAAGGAT

Solyc11g067340/1-1302 GAAAATTCCCTTTCAAAAATATTATACTTTTATTATCCCTTCGGGGGACGTATCAAGGAT

SlASAT3/1-1293 GAAAATTCCCTTTCAAAAGTATTGTCCTTTTATTATCCCTTAGCTGGAAAAATCAATAAT

LA2204-ASAT3-like2/1-1290 GAAAATTCCCTTTCAAAAGTATTATCCTTTTATTATCCCTTAGCGGGAAAAATCAATAAT

LA2204-ASAT3-like1/1-1290 GAAAATTCCCTTTCAAAAGTATTATCCTTTTATTATCCCTTAGCGGGAAAAATCAATAAT

LA2156-ASAT3-like/1-1290 GAAAATTCCCTTTCAAAAGTATTATCCTTTTATTATCCCTTAGCGGGAAAAATCAATAAT

***** ************ ** * * ** ************ * *** ***** **

LA2861-F/1-1290 AATTACACCTATGTCGATTGTAATGACACAGGTGCTGAGTATTTAAACGTCGGTATCAAT

LA1777-F/1-1290 AATTACACCTATGTCGATTGTAATGACACAGGTGCTGAGTATTTAAACGTCCGTATCAAT

LA1978-F/1-1290 AATTACACCTATGTCGATTGTAATGACACAGGTGCTGAGTATTTAAACGTCGGTATCAAT

LA2098-P/1-1287 AATTACACTTATGTCGATTGTAATGATACAGGTGCTGAGTATTTAAATGTCCGTATCGAT

LA2861-P/1-1287 AATTACACCTATGTCGATTGTAATGATACAGGTGTTGAGTATTTAAACGTCCGTATCGAT

LA1978-P/1-1287 AATTACACTTATGTCGATTGTAATGACACAGGTGCTGAGTATTTAAATGTCCGTATCGAT

LA0716/1-1287 AATTACACCTATGTCGATTGTAATGATACAGGTGCTGAGTATTTAAACGTCCGTATCGAT

Solyc11g067290/1-1284 AATAACACCTACGTCGATTGCAATGACATTGGTGTTGAGTATTTAAATGTCAGAATAAAT

Solyc11g067330/1-1302 AAT---AAGTATGTTGATTGCAATGATATAGGCGCTGAGTATTTTAATGTTCATATCAAT

Solyc11g067340/1-1302 AAT---AAGTATGTTGATTGCAATGATATAGGCGCTGAGTATTTTAATGTTCATATCAAT

SlASAT3/1-1293 AATTATACCTACGTCGATTGTAACGACACAGGTGCTGAGTATTTAAACGTCCGTATAGAT

LA2204-ASAT3-like2/1-1290 AATTATACCTATGTCGATTGTAATGACACGGGTGCTGAGTATTTAAACGTCCGTATCGAT

LA2204-ASAT3-like1/1-1290 AATTATACCTATGTCGATTGTAATGACACGGGTGCTGAGTATTTAAACGTCCGTATCGAT

LA2156-ASAT3-like/1-1290 AATTATACCTATGTCGATTGTAATGACACGGGTGCTGAGTATTTAAACGTCCGTATCGAT

*** * ** ** ***** ** ** * ** * ********* ** ** ** **

LA2861-F/1-1290 TGTCCAATGTCTCAAATTATCAACAACCCTTATAATGATGCTGTGGGTGTAGTCTTCCCA

LA1777-F/1-1290 TGTCCAATGTCTCAAATTATCAACAACCCTTATAATGATGCTGTGGGTGTAGTCTTCCCA

LA1978-F/1-1290 TGTCCAATGTCTCAAATTATCAACAACCCTTATAATGATGCTGTGGGTGTAGTCTTCCCA

LA2098-P/1-1287 TGTCCAATGTCTCAAATTATCAACGACCCTTATAATGATGCTGTGGGTGTAGTCTTCCCA

LA2861-P/1-1287 TGTCCAATGTCTCAAATTATCAACGACCCTTATAATGATGCTGTGGGTGTAGTCTTCCCA

LA1978-P/1-1287 TGTCCAATGTCTCAAATTATCAACGACCCTTATAATGATGCTGTGGGTGTAGTCTTCCCA

LA0716/1-1287 TGTCCAATGTCTCAAATTATCAACGACCCTTATAATGATGCTGTGGGTGTAGTCTTCCCA

Solyc11g067290/1-1284 CATTCGATGTCCGATATTCTCAATAGCCGCTGTAATGATGTTGCGGATATAGTCTACCCA

Solyc11g067330/1-1302 TGTCAAATGTCTGAAATACTTAGCAATCCGTATAATGATGCTATTGAGATAGTGTTCCCA

Solyc11g067340/1-1302 TGTCAAATGTCTGAAATACTTAGCAATCCGTATAATGATGCTATTGAGATAGTGTTCCCA

SlASAT3/1-1293 TGTCCAATGTCTCAAATTCTCAACCACCCTTATAACGATGTTGTGGATGTAGTTTTCCCA

LA2204-ASAT3-like2/1-1290 TGTCCAATGTCTCAAATTATCAACGACCCTTATAATGATGTTGTGGGTGTAGTCTTCCCA

LA2204-ASAT3-like1/1-1290 TGTCCAATGTCTCAAATTATCAACGACCCTTATAATGATGTTGTGGGTGTAGTCTTCCCA

LA2156-ASAT3-like/1-1290 TGTCCAATGTCTCAAATTATCAACGACCCTTATAATGATGTTGTGGGTGTAGTCTTCCCA

* ***** * ** * * * * *** **** * * **** * ****

LA2861-F/1-1290 CAAGATTTGCCTtGG---AGTAGTAGCTtGAAT---------CGAAGTCCACTAGTGGTT

LA1777-F/1-1290 CAAGATTTGCCTtGG---AGTAGTAGCTtGAAT---------CGAAGTCCACTAGTGGTT

LA1978-F/1-1290 CAAGATTTGCCTtGG---AGTAGTAGCTtGAAT---------CGAAGTCCACTAGTGGTT

LA2098-P/1-1287 CAAGATTTGCCTTGG---AGTAGTAGCTtGAAT---------CGAAGTCCACTAGTGGTT

LA2861-P/1-1287 CAAGATTTGCCTTGG---AGTACTAGCTTGAAT---------CGAAGTCCACTAGTGGTT

LA1978-P/1-1287 CAAGATTTGCCTtGG---AGTAGTAGCTtGAAT---------Cgaagtccactagtggtt

LA0716/1-1287 CAAGATTTGCCTtGG---AGTAGTAGCtGGAAT---------CGAAGTCCACTAGTGGTT

Solyc11g067290/1-1284 AAAGACTTGCCTTGG---AGTAGTAGCGTGAAT---------CGAAGTCCACTAGTGATT

Solyc11g067330/1-1302 CAAAATTTGGCTTGG---GGTAATTCCTTATCAGAAGAAAGAAGTAGCCTTCTAGTGGTC

Solyc11g067340/1-1302 CAAAATATGGCTTGG---GGTAATTCCTTATCAGAAGAAAGAAGTAGCCTTCTAGTGGTT

SlASAT3/1-1293 CAAGATTTGCCTTGGAGTAGTAGTAGCTTGACT---------CGAAGTCCACTAGTGGTT

LA2204-ASAT3-like2/1-1290 CAAGATTTGCCTtGG---AGTAGTAGCTtGAAT---------CGAAGTCCACTAGTGGTT

LA2204-ASAT3-like1/1-1290 CAAGATTTGCCTtGG---AGTAGTAGCTtGAAT---------CGAAGTCCACTAGTGGTT

LA2156-ASAT3-like/1-1290 CAAGATTTGCCTtGG---AGTAGTAGCTtGAAT---------CGAAGTCCACTAGTGGTT

** * ** ***** *** * * * ** * ****** *

LA2861-F/1-1290 CAATTAAGTCATTTTGATTGTGGTGGAATAGCAGTCAGCGCATGTACATCACATACAATT

LA1777-F/1-1290 CAATTAAGTCATTTTGATTGTGGTGGAATAGCAGTCAGCGCATGTACATCACATACAATT

LA1978-F/1-1290 CAATTAAGTCATTTTGATTGTGGTGGAATAGCAGTCAGCGCATGTACATCACATACAATT

LA2098-P/1-1287 CAATTAAGTCATTTTGATTGTGGTGGAATAGCAGTCAGCGCATGTACATCACATACAATT

LA2861-P/1-1287 CAATTAAGTCATTTTGATTGTGGTGGAATAGCAGTCAGCGCATGTACATCACATACAATT

LA1978-P/1-1287 caattaaGTCATTTtGATtGTgGTGGAATAGCAGTCAGCGCATGTACATCACATACAATT

LA0716/1-1287 CAATTAAGTCATTTTGATTGTGGTGGAATAGCAGTCAGCGCATGTACATCACATACAATT

Solyc11g067290/1-1284 CAGTTAAGTCATTTTGATTGTGGTGGAATAGGACTTGGTGTGTGTTTGTCACACAAAATT

Solyc11g067330/1-1302 CAATTGAGCCATTTTGATTGTGGTGGAGTGGGAATAAGTATATGTCTATCCCACAAGGTT

Solyc11g067340/1-1302 CAATTGAGCCATTTTGATTGTGGTGGAGTGGGAATTAGTATATGTCTATCCCACAAGGTT

SlASAT3/1-1293 CAATTAAGCCATTTTGATTGTGGTGGAGTTGCAGTGAGTGCATGTACATCACATACAATT

LA2204-ASAT3-like2/1-1290 CAATTAAGTCATTTTGATTGTGGTGGAATAGCAGTCAGCGCATGTACATCACATACAATT

LA2204-ASAT3-like1/1-1290 CAATTAAGTCATTTTGATTGTGGTGGAATAGCAGTCAGCGCATGTACATCACATACAATT

LA2156-ASAT3-like/1-1290 CAATTAAGTCATTTTGATTGTGGTGGAATAGCAGTCAGCGCATGTACATCACATACAATT

** ** ** ****************** * * * * * *** ** ** * **

LA2861-F/1-1290 TTTGATGGATATTGTGTCTCTAAaTTCATAAATGATTGGGCGTCTACAGCTCGAAAC---

LA1777-F/1-1290 TTTGATGGATATTGTGTCTCTAAATTTATAAATGATTGGGCGTCTACAGCTCGAAAC---

LA1978-F/1-1290 TTTGATGGATATTGTGTCTCTaAATTCATAAATGATTGGGCGTCTACAGCTCGAAAC---

LA2098-P/1-1287 TTTGATGGACATTCTCTCTCTAAATTCATAAATGATTGGGCGTCTACAGCTCGAAAC---

LA2861-P/1-1287 TTTGATGGACATTCTCTCTCTAAATTCATAAATGATTGGGCGTCTACAGCTCGAAAC---

LA1978-P/1-1287 TTtGATGgACATTCTCTCTCTAAATTCATAAATGATTGGGCGTCTACAGCTCGAAAC---

LA0716/1-1287 TTTGATGGACATTCTCTCTCTAAATTCATAAATGATTGGGCGTCTACAGCTCGAAAC---

Solyc11g067290/1-1284 GTTGATGGATATTGTATAGCTAAATTCATTAGTGATTGGGCCAATACAGCTCGAGAC---

Solyc11g067330/1-1302 GCTGATGGGTATAGCGGGTGTAAGTTCCTTAGTGATTGGGTTTCTATGGCTAGAGACGAT

Solyc11g067340/1-1302 GCTGATGGGTACAGCGCGTTTAAGTTCCTTGGTGATTGGATTTCTATGGCTAGAGACGAT

SlASAT3/1-1293 TTTGATGGATATTGTCTCTCTAAATTCATAAACGATTGGGCGTCTACAGCTCGAAAC---

LA2204-ASAT3-like2/1-1290 TTTGATGGATATtCTCTCTCTAAATTCATAAATGATTGGGCGTCTACAGCTCGAAAC---

LA2204-ASAT3-like1/1-1290 TTTGATGGATATTCTCTCTCTAAaTTCaTAAATGATTGGGCGTCTACAGCTCGAAAC---

LA2156-ASAT3-like/1-1290 TTTGATGGATATTCTCTCTCTAAaTTCaTAAATGATTGGGCGTCTACAGCTCGAAAC---

****** * *** ** * ****** ** *** ** **

LA2861-F/1-1290 ------ATGGATTTCAAACCATCTCCTCAGTTCAGTGCATCTACTTTCTTC---CCTTTA

LA1777-F/1-1290 ------ATGGATTTCAAACCATCTCCTCAGTTCAGTGCATCTACTTTCTTC---CCTTTA

LA1978-F/1-1290 ------ATGGATTTCAAACCATCTCCTCAGTTCAGTGCATCTACTTTCTTC---CCTTTA

LA2098-P/1-1287 ------ATGGATTtcAAACCATCTCCTCAGTTTAATGCATCTACTTTCTTC---CCTTTA

LA2861-P/1-1287 ------ATGGATTTCAAACCATCTCCTCAGTTCAATGCATCAACTTTCTTC---CCTTTA

LA1978-P/1-1287 ------ATGGATTTCAAaCCATCTCCTCAGTTTAATGCATCTACTTTCTTC---CCTTTA

LA0716/1-1287 ------ATGGATTTTAGACCATCTCCTCAGTTCAATGCATCTACTTTCTTC---CCTTTA

Solyc11g067290/1-1284 ------ATGGATTTCAAACCATCAATTAAATTCAATGCATCTACATTTTTT---CCACTA

Solyc11g067330/1-1302 CATAAATTAAATTTCCAACTATCTTGTCAGTTTGATGGAGCTTCCTTCTTTCCACCAATA

Solyc11g067340/1-1302 CATAAATTAAATTTCCAACCATCTCCTCAGTTTGATGGAGCTTTGTTCCTTCCACCAATA

SlASAT3/1-1293 ------ATGGAGTTCAAACCATCTCCTCAGTTCAATGCATCAACTTTCTTC---CCTTTA

LA2204-ASAT3-like2/1-1290 ------ATGGATTTCAAACCATCTCCTCAGTTCAATGCATCTACTTTCTTC---CCTTTA

LA2204-ASAT3-like1/1-1290 ------ATGGATTTCAAACCATCTCCTCAGTTCAATGCATCTACTTTCTTC---CCTTTA

LA2156-ASAT3-like/1-1290 ------ATGGATTTCAAACCATCTCCTCAGTTCAATGCATCTACTTTCTTC---CCTTTA

* * ** ** *** * * ** ** * * ** * ** **

LA2861-F/1-1290 CCGTCTGAAACTAATTTGAGTAGTACCCTACCCCCAACGCAACCATCAAAACGTCATGTC

LA1777-F/1-1290 CCGTCTGAAACTAATTTGAGTAGTACCCTACCCACAACGCATCCATCAAAACGTCATGTC

LA1978-F/1-1290 CCGTCTGAAACTAATTTGAGTAGTACCCTACCCCCAACGCAACCATCAAAACGTCATGTC

LA2098-P/1-1287 CCGTCTGAACCTAATTTGAGTAGTACCCTACCCACAACGCATCCATCAAAACGTCATGTC

LA2861-P/1-1287 CCGTCTGAAACTAATTTGAGTAGTACCCTACCCACAACGCATCCATCAAAATGTCATGTC

LA1978-P/1-1287 CCGTCTGAAACTAATTTGAGTAGTACCCTACCCACAACGCATCCATCAAAACGTCATGTC

LA0716/1-1287 CCGTCTGAAACTAATTTGAGTAGTACCCTACCCACAAAGCATCCATCAAAACGTCATGTC

Solyc11g067290/1-1284 ATCGAGGGTGCACCAAATATTATGTCTATAAATAGTTCTCCTCAATCACAACGATACGTG

Solyc11g067330/1-1302 GATAATCCTCCACCTATGCCTAATGTTGTGCCTGAT---------CCAGAACGATGTGTG

Solyc11g067340/1-1302 GATAATCCTCCACCTATGCCTAATGTTGTGCCTGAC---------CCTCAACAATGTGTG

SlASAT3/1-1293 CCGTCTGAAACTAATTTGAGTAGCACCCTACCTGCAACGCGTCCATCACAACGTCATGTC

LA2204-ASAT3-like2/1-1290 CCGTCTGAAACTAATTTGAGTAGTACCCTACCTACAACGCATCCATCACAACGTCATGTC

LA2204-ASAT3-like1/1-1290 CCGTCTGAAACTAATTTGAGTAGTACCCTACCTACAACGCATCCATCACAACGTCATGTC

LA2156-ASAT3-like/1-1290 CCGTCTGAAACTAATTTGAGTAGTACCCTACCTACAACGCATCCATCACAACGTCATGTC

* ** * * ** **

LA2861-F/1-1290 TCAAGAATGTACAATTTCTCATCCTCGAATTTGACAAGACTCAAGGAT---ATGGTAACA

LA1777-F/1-1290 TCAAGAATGTACAATTTCTCATCCTCGAATTTGACAAGACTCAAGGAT---ATCGTAACA

LA1978-F/1-1290 TCAAGAATGTACAATTTCTCATCCTCGAATTTGACAAGACTCAAGGAT---ATGGTAACA

LA2098-P/1-1287 TCAAGAATGTACAATTTCTCATCCTCGAATTTGACAAGACTCAAGGAT---ATCGTAACA

LA2861-P/1-1287 TCAAGAATGTACAATTTCTCATCCTCGAATTTGACAAGACTCAAGGAT---ATCGTAACA

LA1978-P/1-1287 TCAAGAATGTACAATTTCTCATCCTCGAATTTGACAAGACTCAAGGAT---ATCGTAACA

LA0716/1-1287 TCAAGAATGTACAATTTCTCATCCTCGAATTTGACAAGACTCAAGGAT---ATGGTAACA

Solyc11g067290/1-1284 TCAAGAGCCTACAATTTCTCATCCTCGAACTTAAAAAGACTCAAAAGG---AGCATTACC

Solyc11g067330/1-1302 TCAAGAATGTACAATTTGTCATCATCTACCTTACTCAAACTCAAGGATATTGTTGTTTCA

Solyc11g067340/1-1302 TCAAGAATGTACAATTTGTCATCATCTACCTTGTCTAAACTCAAGGATAGTATTGTTTCA

SlASAT3/1-1293 TCAAGAATGTATAACTTCTCATCCTCGAATTTGACAAGACTCAAGGAC---ATCGTAACA

LA2204-ASAT3-like2/1-1290 TCAAGAATGTACAATTTCTCATCCTCGAATTTGACAAGACTCAAGGAT---ATCGTAACA

LA2204-ASAT3-like1/1-1290 TCAAGAATGTACAATTTCTCATCCTCGAATTTGACAAGACTCAAGGAT---ATCGTAACA

LA2156-ASAT3-like/1-1290 TCAAGAATGTACAATTTCTCATCCTCGAATTTGACAAGACTCAAGGAT---ATCGTAACA

****** ** ** ** ***** ** * ** * ****** * *

LA2861-F/1-1290 AAAGAATCACATGTAAAGAATCCAACTCGCATTGAAGTTGCCTCAGCACATGTTCATAAA

LA1777-F/1-1290 AAAGAATCACATGTAAAGAATCCAACTCGCATTGAAGTTGCCTCAGCACTTGTTCATAAA

LA1978-F/1-1290 AAAGAATCACATGTAAAGAATCCAACTCGCATTGAAGTTGCCTCAGCACTTGTTCATAAA

LA2098-P/1-1287 AAAGAATCACATGTAAAGAATCCAACTCGCATTGAAGTTGCCTCAGCACTTGTTCATAAA

LA2861-P/1-1287 AAAGAATCACATGTAAAGAATCCAACTCGCATTGAAGTTGCCTCAGCACTTGTTCATAAG

LA1978-P/1-1287 AAAGAATCACATGTAAAGAATCCAACTCGCATTGAAGTTGCCTCAGCACTTGTTCATAAA

LA0716/1-1287 AAAGAATCACATGTAAAGAATCCAACTCGCATTGAAGTTGCCTCGGCACTTGTTCATAAA

Solyc11g067290/1-1284 GGA---------GTTCAAAATCCAACTCGCGTTGAAGTTGCGACGTCACTTATTCATAAA

Solyc11g067330/1-1302 ACAAATCCACAAATACAAAATCCATCTCGCATTGAAGTTGCCACAGCACTTTTTCATAAG

Solyc11g067340/1-1302 ACAAATCCACAAATACAAAATCCATCTCGCATTGAAGTTGCCATGGCACTTATTCATAAG

SlASAT3/1-1293 AAAGAATCACATGTGAAGAATCCAACTCGCGTTGAAGTTGCCTCAGCACTTGTTCATAAA

LA2204-ASAT3-like2/1-1290 AAAGAATCACATGTAAAGAATCCAACTCGCGTTGAAGTTGCCTCAGCACTTGTTCATAAA

LA2204-ASAT3-like1/1-1290 AAAGAATCACATGTAAAGAATCCAACTCGCGTTGAAGTTGCCTCAGCACTTGTTCATAAA

LA2156-ASAT3-like/1-1290 AAAGAATCACATGTAAAGAATCCAACTCGCGTTGAAGTTGCCTCAGCACTTGTTCATAAA

* * * ****** ***** ********** *** * *******

LA2861-F/1-1290 TGTGGGGTGGCTATGTCAATGGAGAAATCAGGCATATTCAAACCAACTCTAATGAGCCAT

LA1777-F/1-1290 TGTGGGGTGGCTATGTCAATGGAGAAATCAGGCATATTCAAACCAACTCTAATGAGCCAT

LA1978-F/1-1290 TGTGGGGTGGCTATGTCAATGGAGAAATCAGGCACATtCAAACCAACTCTAATGAGCCAT

LA2098-P/1-1287 TGTGGGGTGACTATGTCAATGGAGAAATCAGGCATGTTCAAACCAACTCTAATGATCCAT

LA2861-P/1-1287 TGTGGGGTGACTATGTCAATGGAGAAATCAGGCATGTTCAAACCAACTCTAATGATCCAT

LA1978-P/1-1287 TGTGGGGTGACTATGTCAATGGAGAAACCAGGCATGTTCAAACCAACTCTAATGATCCAT

LA0716/1-1287 TGTGGGGTGACTATGTCAATGGAGAAATCAGGCATGTTCAAACCAACTCTAATGACCCAT

Solyc11g067290/1-1284 TGTGGGGCGATTGCGTCGATGAAAAATTTGGGCTCGTTTAAACCATCTTTGATAAGCCAG

Solyc11g067330/1-1302 TGTGGGGTTGATGTGTCAATGGCAAAATCAGGCGTGTTTAGACGAACTGTGTTATTCCAT

Solyc11g067340/1-1302 TGCGGGGTTGATGTGTCGATGTCAAAATCAGGCGTGTTTAGACCAACTATGTTATACCAG

SlASAT3/1-1293 TGTGGGGTGACTATGTCAATGGAGAGTTCAGGCATGTTCAAACCAACTCTGATGAGCCAT

LA2204-ASAT3-like2/1-1290 TGTGGGGTGACTATGTCAATGGAGAAATCAGGCATGTTCAAACCAACTCTAATGAGCCAT

LA2204-ASAT3-like1/1-1290 TGTGGGGTGACTATGTCAATGGAGAAATCAGGCAtgTtCAAACCAACTCTAATGAGCCAT

LA2156-ASAT3-like/1-1290 TGTGGGGTGACTATGTCAATGGAGAAATCAGGCAtGTtCAAACCAACTCTAATGAGCCAT

** **** * *** *** * *** ** * ** * ** * * ***

LA2861-F/1-1290 GCTATGAATTTACGCCCACCAATTCCACTAAACACAATGGGAAATGCAACATGTATCATT

LA1777-F/1-1290 GCTATGAATTTACGCCCACCAATTCCACTAAACACAATGGGAAATGCAACATGTATCATT

LA1978-F/1-1290 GCTATGAATTTACGCCCACCAATTCCACTAAACACAATGGGAAATGCAACATGTATCATT

LA2098-P/1-1287 GCTATGAATTTACGCCCACCAATTCCACTAAACACAATGGGAAATGCAGTATGTATCATT

LA2861-P/1-1287 GCTATGAATTTACGCCCACCAATTCCACTAAACACAATGGGAAATGCAGTATGTATCATT

LA1978-P/1-1287 GCTATGAATTtACGCCCACCAATTCCACTAAACACAATGGGAAATGCAGTATGTATCATT

LA0716/1-1287 GCTATGAATTTACGCCCACCAATTCCACTAAACACAATGGGAAATGCAGTATGTATCATT

Solyc11g067290/1-1284 GTAATAAATTTACGCCCTTTAATTCCGCTAGACACGATGGGAAATGCGACGTGTATCTAT

Solyc11g067330/1-1302 GTAATGAATTTACGCCCTCCTATTCCATTCAACACAATAGGAAATGCTACTTGTTACTTT

Solyc11g067340/1-1302 GTAATGAATTTACGCCCCCCTATTCCACTCAACACAATGGGAAATGCTACTTGTCTCTTT

SlASAT3/1-1293 GCTATGAATTTACGCCCACCAATTCCACTGAACACAATGGGAAATGCAACATGTATCATT

LA2204-ASAT3-like2/1-1290 GCTATGAATTTACGCCCACCAATTCCACTAAACACAATGGGAAATGCAACATGTATCATT

LA2204-ASAT3-like1/1-1290 GCTATGAATTTACGCCCACCAATTCCACTAAACACAATGGGAAATGCAACATGTATCATT

LA2156-ASAT3-like/1-1290 GCTATGAATTTACGCCCACCAATTCCACTAAACACAATGGGAAATGCAACATGTATCATT

* ** *********** ***** * **** ** ******** *** * *

LA2861-F/1-1290 CTCACAACAACAATGACAGAAGATGAGGTAAAACTTCCAAACTTTGTTGCTAAACTACAG

LA1777-F/1-1290 CTCACAACAACAATGACAGAAGATGAGGTAAAACTTCCAAACTTTGTTGCTAAACTACAG

LA1978-F/1-1290 CTCACaACAACaATGACAGAAGATGAGGTAAAACTTCCAAACTTTGTTGCTAAACTACAG

LA2098-P/1-1287 CTCACAACAACAGTGACAGAAGATGAGGTAAAACTTCCAAACTTTGTTGCTAAACTACAG

LA2861-P/1-1287 CTCACAACAACAGTGACAGAAGATGAGGTAAAACTTCCACACTTTGTTGCTAAACTACAG

LA1978-P/1-1287 CTCACAACAACAGTGACAGAAGATGAGGTAAAACTTCCAAACTTTGTTGCTAAACTACAG

LA0716/1-1287 CTCACAACAACAGTGACAGAAGATGAGGTAAAACTTCCAAACTTTGTTGCTAAACTACAG

Solyc11g067290/1-1284 AGCATAATAGCAACGACGGAAAACGAGATAGAGTTGCCTAACTACGTCGCTCAGATGCAA

Solyc11g067330/1-1302 AGCACAAGAGCAATGAGTATAGATAAAACAACGTTACCAAACTATGTTGGTGAGTTACAA

Solyc11g067340/1-1302 AGCACAATAGCAATGAGTATAGATAAAACAACGTTACCAAGCTATGTTGGTGAGTTACAA

SlASAT3/1-1293 CTCACAACAGCAATGACAGAAGATGAGGTAAAACTTCCAAACTTTGTTGCTAAACTACAG

LA2204-ASAT3-like2/1-1290 CTCACAACAACAATGACAGAAGATGAGGTAAAACTTCCAAACTTTGTTGCTAAACTACAG

LA2204-ASAT3-like1/1-1290 CTCACAACAACAATGACAGAAGATGAGGTAAAACTTCCAAACTTTGTTGCTAAACTACAG

LA2156-ASAT3-like/1-1290 CTCaCAaCAACAaTGACAGAAGATGAGGTAAAACTTCCAAACTTTGTTGCTAAACTACAG

** ** * ** ** * * * * * ** ** ** * * * * **

LA2861-F/1-1290 AAGGATAAACAACAACTTCGAGACAAGTTGAAGGATATGAAAAAAGATATGATGCCCTTG

LA1777-F/1-1290 AAGGATAAACAACAACTTCGAGACAAGTTGAAGGATATGAAAAAAGATATGATGCCCTTG

LA1978-F/1-1290 AAGGATAAACAACAACTTCGAGACAAGTTGAAGGATATGAAAAAAGATATGATGCCCTTA

LA2098-P/1-1287 AAGGATAAACAACAACTTCGAGACAAGTTGAAGGATATGAAAAAAGATATGATGCCCTTA

LA2861-P/1-1287 AAGGATAAACAACAACTTCGTGACAAGTTGAAGGATATGAAAAAAGATATGATGCCCTTA

LA1978-P/1-1287 AAGGATAAACAACAACTTCGAGACAAGTTGAAGGATATGAAAAAAGATATGATGCCCTTA

LA0716/1-1287 AAGGATAAACAACAACTTCGAGACAAGTTGAAGGATATGAAAAAAGATATGATGCCCTTA

Solyc11g067290/1-1284 AATGTTAAACAACAAATTCGAAACGAGTTGAAGAATCTAGATACGGATAAGATAGTTCCA

Solyc11g067330/1-1302 AAGGCTAAACAACAAATTCGATACGAATTGAAAGATATGAACACAAAGGAACTAGCCTTA

Solyc11g067340/1-1302 AAGGCTAAACAACAACTTCGACATAAATTGAAACAAATGGACACAAATCAACTAGCCTCA

SlASAT3/1-1293 AAGGATAAACAACAACTTCGAGACAAGTTGAAGGATATGAAAGAAGATAGGATGCCCTTA

LA2204-ASAT3-like2/1-1290 AAGGATAAACAACAACTTCGAGACAAGTTGAAGGATATGAAAAAAGATATGATGCCCTTG

LA2204-ASAT3-like1/1-1290 AAGGATAAACAACAACTTCGAGACAAGTTGAAGGATATGAAAAAAGATATGATGCCCTTG

LA2156-ASAT3-like/1-1290 AAGGATAAACAACAACTTCGAGACAAGTTGAAGGATATGAAAAAAGATATGATGCCCTTG

** * ********** **** * * ***** * * * * *

LA2861-F/1-1290 TATACACTTGAACTAGCTAAAAACGCGATGAACATAATAGAGAAGGATACACATGATGTT

LA1777-F/1-1290 tATACACTTGAACTAGCTAAAAACGCGATGAACATAATAGAGAAGGATACACATGATGTT

LA1978-F/1-1290 TATACACTTGAACTGGGTAAAAAAGCGATGAACATAATAGAGAAGGATACACATGATGTT

LA2098-P/1-1287 TATACACTTGAACTAGCTAAAAACGGGATGAACATAATAGAGAAGGGTACACATGATGTT

LA2861-P/1-1287 TATACACTTGAACTAGGTAAAAACGCGATGAACATAATAGAGAAGGATACACATGATGTT

LA1978-P/1-1287 CATACACTTGAACTAGGTAAAAACGCGATGAACATAATAGAGAAGGATACACATGATGTT

LA0716/1-1287 TATACACTTGAACTAGGTAAAAACGCGATGAACATAATAGAGAAGGATACACATGATGTT

Solyc11g067290/1-1284 TATACACTTGAAAAAGTGAGAGGCATTGTAGACATAATGGAGAAGGATATATTTGATATT

Solyc11g067330/1-1302 CATGCAATCGAAAAAATTAAAGAGATTGTGAACATAGCAAAGGATGATTGTTTTGACATG

Solyc11g067340/1-1302 CATGCAATTGAAAAACTTAAAGAGATTGTAAACATAGCAAATGAGGATGTATTTGACATA

SlASAT3/1-1293 TATACACTTGAACTAGGTAAAAACGCGATGAACATAATAGAGAAGGATACACATGATGTT

LA2204-ASAT3-like2/1-1290 TATACACTTGAACTAGGTAAAAACGCGATGAACATAATAGAGAAGGATACACATGATGTT

LA2204-ASAT3-like1/1-1290 TATACACTTGAACTAGGTAAAAACGCGATGAACATAATAGAGAAGGATACACATGATGTT

LA2156-ASAT3-like/1-1290 TATACACTTGAACTAGGTAAAAACGCGATGAACATAATAGAGAAGGATACACATGATGTT

** ** * *** * * * ***** * * * * *** *

LA2861-F/1-1290 TATCTTTGCTCAGGCATGACCAATACTGGATTACAT---AAGATCGATTTCGGATGGGGT

LA1777-F/1-1290 TATCTTTGCTCAGGCATGACCAATACTGGATTACAT---AAGATCGATTTCGGATGGGGT

LA1978-F/1-1290 TATCTTTGCTCAGGCATGACCAATACTGGATTACAT---AAGATCGATTTCGGATGGGGT

LA2098-P/1-1287 TATGGTTGCTCAGGCATGACCAATACTGGATTACAT---AAGATCGATTTCGGATGGGGT

LA2861-P/1-1287 TATGTTTGCTCAGGCATGACCAATACTGGATTACAT---AAGATCGATTTCGGATGGGGT

LA1978-P/1-1287 TATCTTTGCTCAGGCATGACCAATACTGGATTACAT---AAGATCGATTTCGGATGGGGT

LA0716/1-1287 TATGTTTGCTCAGGCATGACCAATACTGGATTACAT---AAGATCGATTTCGGATGGGGT

Solyc11g067290/1-1284 TATTTATCAACAAGTGTACACAATTTTGGACTATATAGTAAGGCTAATTTTGGATGGGGC

Solyc11g067330/1-1302 TATTTTTGCACAAGTTTGTGCACTTTTGGGTCACGT---AAGATTGATTTCGGATGGGGT

Solyc11g067340/1-1302 TATTTTTGTACAAGTTTGTGCACTTTTGGGTCACAT---AAGATTGATTTTGGATGGGGT

SlASAT3/1-1293 TATCTTTGCTCAGGCATGACCAATACTGGATTACAT---AAGATCGATTTCGGATGGGGT

LA2204-ASAT3-like2/1-1290 TATCTTTGCTCAGGCATGACCAATACTGGATTACAT---AAGATCGATTTCGGATGGGGT

LA2204-ASAT3-like1/1-1290 TATCTTTGCTCAGGCATGACCAATACTGGATTACAT---AAGATCGATTTCGGATGGGGT

LA2156-ASAT3-like/1-1290 TATCTTTGCTCAGGCATGACCAATACTGGATTACAT---AAGATCGATTTCGGATGGGGT

*** * ** * * ** * *** * * *** **** ********

LA2861-F/1-1290 GAACCTGTAAGAGTAACCCTAGCAACACATCCAAATAAGAACAACTTCATTTTCATGGAT

LA1777-F/1-1290 GAACCTGTAAGAGTAACCCTAGCAACACATCCAAATAAGAACAACTTCATTTTCATGGAT

LA1978-F/1-1290 GAACCTGTAAGAGTAACCCTAGCAACACATCCAAATAAGAACAACTTCATTTTCATGGAT

LA2098-P/1-1287 GAACCTGTAAGAGTAACCCTAGCAACT---TCAAATAAGAACAACTTCATTTTCATGGAT

LA2861-P/1-1287 GAACCTGTAAGAGTAACCCTAGCAACT---TCAAATAAGAACAACTTCATTTTCATGGAT

LA1978-P/1-1287 GAACCTGTAAGAGTAACCCTAGCAACTTCAAAAAAC---AACAACTTCATTTTCATGGAT

LA0716/1-1287 GAACCTGTAAGAGTAACCCTAGCAACT---TCAAATAAGAACAACTTCATTTTCATGGAT

Solyc11g067290/1-1284 AAGCCTATAAAAGTTTCTAATACAAAATATCCAACTAAGAAAAGTATCATGCTTTTTGAT

Solyc11g067330/1-1302 AGCCCCCTAAGAGTGACTCATGTGAAAGATCCAATGAAAAATAAATTTATTTTCATGGAT

Solyc11g067340/1-1302 AGCCCCCTAAGAGTGACTCAAGTGAAACATCCAACTAAAAATAAATTTATGTTCCTGGAT

SlASAT3/1-1293 GAACCTGTAAGAGTAACCCTAGCAACACATCCAAATAAGAACAACTTCATTTTCATGGAT

LA2204-ASAT3-like2/1-1290 GAACCTGTAAGAGTAACCCTAGCAACACATCCAAATAAGAACAACTTCATTTTCATGGAT

LA2204-ASAT3-like1/1-1290 GAACCTGTAAGAGTAACCCTAGCAACACATCCAAATAAGAACAACTTCATTTTCATGGAT

LA2156-ASAT3-like/1-1290 GAACCTGTAAGAGTAACCCTAGCAACACATCCAAATAAGAACAACTTCATTTTCATGGAT

** *** *** * * ** ** * * ** * * ***

LA2861-F/1-1290 GAACAAAGTGGAGATGGGCTAAATGTACTTATCACTTTAACAAAAGATGATATGCTGAAG

LA1777-F/1-1290 GAACAAAGTGGAGATGGGCTAAATGTACTTATCACTTTAACAAAAGATGATATGCtGAAG

LA1978-F/1-1290 GAACAAAGTGGAGATGGGCTAAATGTACTTATCACTTTAACAAAAGATGATATGCTGAAg

LA2098-P/1-1287 GAACAAAGTGGAGATGGGCTAAATGTACTTATCACTTtAACAAAAGATGATATGCTGAAG

LA2861-P/1-1287 GAACAAAGTGGAGATGGGCTAAATGTACTTATCACTTTAACAAAAGATGATATGCtGAAG

LA1978-P/1-1287 GAACAAAGTGGAGATGGGCTAAATGTACTTATCACTTtAACAAAaGATGATATGCtGAAG

LA0716/1-1287 GAACAAAGTGGAGATGGGCTAAATGTACTTATCACTTTAACAAAAGATTATATGCtGAAG

Solyc11g067290/1-1284 GACCCAAGTGAAGAAGGGATAGATGCACAAATCACCTTAACAGAAGATGAAATGGCAATT

Solyc11g067330/1-1302 GATCCAAGTGGTGAAGGAATAAATGTACTAATCACTTTGACTGAGGCTGATATGTTACTA

Solyc11g067340/1-1302 GATCCAAGTGGAGAAGGGATAAATGTACTAATCACTTTGACTGAGGCTGATATGTTACTA

SlASAT3/1-1293 GAACAAAGTGGAGATGGGCTAAATGTACTTATCACTTTAACAAAAGATGATATGCTCAAG

LA2204-ASAT3-like2/1-1290 GAACAAAGTGGAGATGGGCTAAATGTACTTATCACTTtAACAAAAGATGATATGCtGAAG

LA2204-ASAT3-like1/1-1290 GAACAAAGTGGAGATGGGCTAAATGTACTTATCACTTTAACAAAAGATGATATGCTGAAG

LA2156-ASAT3-like/1-1290 GAACAAAGTGGAGATGGGCTAAATGTACTTATCACTTtAACAAAAGATGATATGCtGAAG

** * ***** ** ** ** *** ** ***** ** ** * * * * ***

LA2861-F/1-1290 TTTCAGAGCAACAAGGAGCTTCTAGAGTTTGCTTCTCCAGTTGTTGAATCAACCAAATAA

LA1777-F/1-1290 tTTCAGAGCAACAAGGAGCTTCTAGAGTTTGCTTCTCCAGTTGTTGAATCAACCAAATAA

LA1978-F/1-1290 tTTCAGAGCaACAAGGAGCTTCTAGAGTTTGCTTCTCCAGTTGTTGAATCAACCAAATAA

LA2098-P/1-1287 TTtCAGAGCAACAAGGAGCTTCTAGAGTTTGCTTCTCCAGTTGTTGAATCAACCAAATAA

LA2861-P/1-1287 TTtCAGAGCAACAAGGAGCTTCTAGAGTTTGCTTCTCCAGTTGTTGAATCAACCAAATAA

LA1978-P/1-1287 TTtCAGAgcaacaaggagcttctagagtttgcttctccagttgttgaatcaacCaaataa

LA0716/1-1287 tTTCAGAGCAACAAGGAGCTTCTAGAGTTTGCTTCTCCAGTTGTTGAATCAACCaaataa

Solyc11g067290/1-1284 TTTCAAGAGGACAAAGAGCTTCTAGAGTTTGCTTCTCCAATGGTTCAATCAACAAAATAA

Solyc11g067330/1-1302 TTTGAGAGTAACAAAGAGCTTCTAGAGTTTGCTTCTCCCGTTGTCCAGTCACTAGAATAA

Solyc11g067340/1-1302 TTTCAAAATAACAAAGAGCTTCTAGAGTTTGCTTCTCCCGTTGTCCAGTCACTAGAATAA

SlASAT3/1-1293 TTTCAGAGCAACAAGGAGCTTCTGGAGTTTGCTTCTCCAGTTGTTGAATCAACCAAATAA

LA2204-ASAT3-like2/1-1290 TTtCAGAGCAACAAGGAGCTTCTAGAGTTTGCTTCTCCAGTTGTTGAATCAACCAAATAA

LA2204-ASAT3-like1/1-1290 TTTCAGAGCAACAaGGAGCTTCTAGAGTTTGCTTCTCCAGTTGTTGAATCAACCAAATAA

LA2156-ASAT3-like/1-1290 TTtCAGAGCAACAAGGAGCTTCTAGAGTTTGCTTCTCCAGTTGTTGAATCAACCAAATAA



*** * **** ******** ************** * ** * *** *****


Verilənlər bazası müəlliflik hüququ ilə müdafiə olunur ©azrefs.org 2016
rəhbərliyinə müraciət

    Ana səhifə